VCFs to artifacts and
back againThe alabaster.vcf
package implements methods to save VCF objects to file
artifacts and load them back into R. This refers specifically to the
SummarizedExperiment subclasses (i.e.,
CollapsedVCF and ExpandedVCF) that are used to
represent the variant calling data in an R session, which may contain
additional modifications that cannot be easily stored inside the
original VCF file. Check out the alabaster.base
for more details on the motivation and concepts of the
alabaster framework.
Given a VCF object, we can use
stageObject() to save it inside a staging directory:
library(VariantAnnotation)
fl <- system.file("extdata", "structural.vcf", package="VariantAnnotation")
vcf <- readVcf(fl, genome="hg19")
vcf## class: CollapsedVCF
## dim: 7 1
## rowRanges(vcf):
## GRanges with 5 metadata columns: paramRangeID, REF, ALT, QUAL, FILTER
## info(vcf):
## DataFrame with 10 columns: BKPTID, CIEND, CIPOS, END, HOMLEN, HOMSEQ, IMPR...
## info(header(vcf)):
## Number Type Description
## BKPTID . String ID of the assembled alternate allele in the asse...
## CIEND 2 Integer Confidence interval around END for imprecise var...
## CIPOS 2 Integer Confidence interval around POS for imprecise var...
## END 1 Integer End position of the variant described in this re...
## HOMLEN . Integer Length of base pair identical micro-homology at ...
## HOMSEQ . String Sequence of base pair identical micro-homology a...
## IMPRECISE 0 Flag Imprecise structural variation
## MEINFO 4 String Mobile element info of the form NAME,START,END,P...
## SVLEN . Integer Difference in length between REF and ALT alleles
## SVTYPE 1 String Type of structural variant
## geno(vcf):
## List of length 4: GT, GQ, CN, CNQ
## geno(header(vcf)):
## Number Type Description
## GT 1 String Genotype
## GQ 1 Float Genotype quality
## CN 1 Integer Copy number genotype for imprecise events
## CNQ 1 Float Copy number genotype quality for imprecise events
library(alabaster.vcf)
tmp <- tempfile()
dir.create(tmp)
meta <- stageObject(vcf, tmp, "vcf")
.writeMetadata(meta, tmp)## $type
## [1] "local"
##
## $path
## [1] "vcf/experiment.json"
## [1] "vcf/assay-1/array.h5"
## [2] "vcf/assay-1/array.h5.json"
## [3] "vcf/assay-2/array.h5"
## [4] "vcf/assay-2/array.h5.json"
## [5] "vcf/assay-3/array.h5"
## [6] "vcf/assay-3/array.h5.json"
## [7] "vcf/assay-4/array.h5"
## [8] "vcf/assay-4/array.h5.json"
## [9] "vcf/coldata/simple.csv.gz"
## [10] "vcf/coldata/simple.csv.gz.json"
## [11] "vcf/experiment.json"
## [12] "vcf/fixed/column1/sequence.fa.gz"
## [13] "vcf/fixed/column1/sequence.fa.gz.json"
## [14] "vcf/fixed/column1/set.json"
## [15] "vcf/fixed/column2/concatenated/simple.csv.gz"
## [16] "vcf/fixed/column2/concatenated/simple.csv.gz.json"
## [17] "vcf/fixed/column2/grouping.csv.gz"
## [18] "vcf/fixed/column2/grouping.csv.gz.json"
## [19] "vcf/fixed/simple.csv.gz"
## [20] "vcf/fixed/simple.csv.gz.json"
## [21] "vcf/header/header.bcf"
## [22] "vcf/header/header.bcf.json"
## [23] "vcf/info/column1/concatenated/simple.csv.gz"
## [24] "vcf/info/column1/concatenated/simple.csv.gz.json"
## [25] "vcf/info/column1/grouping.csv.gz"
## [26] "vcf/info/column1/grouping.csv.gz.json"
## [27] "vcf/info/column2/concatenated/simple.csv.gz"
## [28] "vcf/info/column2/concatenated/simple.csv.gz.json"
## [29] "vcf/info/column2/grouping.csv.gz"
## [30] "vcf/info/column2/grouping.csv.gz.json"
## [31] "vcf/info/column3/concatenated/simple.csv.gz"
## [32] "vcf/info/column3/concatenated/simple.csv.gz.json"
## [33] "vcf/info/column3/grouping.csv.gz"
## [34] "vcf/info/column3/grouping.csv.gz.json"
## [35] "vcf/info/column5/concatenated/simple.csv.gz"
## [36] "vcf/info/column5/concatenated/simple.csv.gz.json"
## [37] "vcf/info/column5/grouping.csv.gz"
## [38] "vcf/info/column5/grouping.csv.gz.json"
## [39] "vcf/info/column6/concatenated/simple.csv.gz"
## [40] "vcf/info/column6/concatenated/simple.csv.gz.json"
## [41] "vcf/info/column6/grouping.csv.gz"
## [42] "vcf/info/column6/grouping.csv.gz.json"
## [43] "vcf/info/column8/concatenated/simple.csv.gz"
## [44] "vcf/info/column8/concatenated/simple.csv.gz.json"
## [45] "vcf/info/column8/grouping.csv.gz"
## [46] "vcf/info/column8/grouping.csv.gz.json"
## [47] "vcf/info/column9/concatenated/simple.csv.gz"
## [48] "vcf/info/column9/concatenated/simple.csv.gz.json"
## [49] "vcf/info/column9/grouping.csv.gz"
## [50] "vcf/info/column9/grouping.csv.gz.json"
## [51] "vcf/info/simple.csv.gz"
## [52] "vcf/info/simple.csv.gz.json"
## [53] "vcf/rowdata/column1/simple.txt.gz"
## [54] "vcf/rowdata/column1/simple.txt.gz.json"
## [55] "vcf/rowdata/simple.csv.gz"
## [56] "vcf/rowdata/simple.csv.gz.json"
## [57] "vcf/rowranges/ranges.csv.gz"
## [58] "vcf/rowranges/ranges.csv.gz.json"
## [59] "vcf/rowranges/seqinfo/simple.csv.gz"
## [60] "vcf/rowranges/seqinfo/simple.csv.gz.json"
We can then load it back into the session with
loadObject().
meta <- acquireMetadata(tmp, "vcf/experiment.json")
roundtrip <- loadObject(meta, tmp)
class(roundtrip)## [1] "CollapsedVCF"
## attr(,"package")
## [1] "VariantAnnotation"
More details on the metadata and on-disk layout are provided in the schema.
We do not use VCF itself as our file format as the VCF
may be decorated with more information (e.g., in the
rowData or colData) that may not be easily
stored in a VCF file. The VCF file is not amenable to random access of
data, either for individual variants or for different aspects of the
dataset, e.g., just the row annotations. Finally, it allow
interpretation of the data as the SummarizedExperiment base class.
The last point is worth some elaboration. Downstream consumers do not
necessarily need to know anything about the VCF data
structure to read the files, as long as they understand how to interpret
the base summarized_experiment schema:
## class: RangedSummarizedExperiment
## dim: 7 1
## metadata(0):
## assays(4): GT GQ CN CNQ
## rownames(7): 1:13220_T/<DEL>
## 1:2827693_CCGTGGATGCGGGGACCCGCATCCCCTCTCCCTTCACAGCTGAGTGACCCACATCCCCTCTCCCCTCGCA/C
## ... 3:12665100_A/<DUP> 4:18665128_T/<DUP:TANDEM>
## rowData names(1): paramRangeID
## colnames(1): NA00001
## colData names(1): Samples
## R version 4.5.2 (2025-10-31)
## Platform: x86_64-pc-linux-gnu
## Running under: Ubuntu 24.04.3 LTS
##
## Matrix products: default
## BLAS: /usr/lib/x86_64-linux-gnu/openblas-pthread/libblas.so.3
## LAPACK: /usr/lib/x86_64-linux-gnu/openblas-pthread/libopenblasp-r0.3.26.so; LAPACK version 3.12.0
##
## locale:
## [1] LC_CTYPE=en_US.UTF-8 LC_NUMERIC=C
## [3] LC_TIME=en_US.UTF-8 LC_COLLATE=C
## [5] LC_MONETARY=en_US.UTF-8 LC_MESSAGES=en_US.UTF-8
## [7] LC_PAPER=en_US.UTF-8 LC_NAME=C
## [9] LC_ADDRESS=C LC_TELEPHONE=C
## [11] LC_MEASUREMENT=en_US.UTF-8 LC_IDENTIFICATION=C
##
## time zone: Etc/UTC
## tzcode source: system (glibc)
##
## attached base packages:
## [1] stats4 stats graphics grDevices utils datasets methods
## [8] base
##
## other attached packages:
## [1] alabaster.se_1.9.0 alabaster.vcf_1.10.0
## [3] alabaster.base_1.11.1 VariantAnnotation_1.57.0
## [5] Rsamtools_2.27.0 Biostrings_2.79.2
## [7] XVector_0.51.0 SummarizedExperiment_1.41.0
## [9] Biobase_2.71.0 GenomicRanges_1.63.0
## [11] IRanges_2.45.0 S4Vectors_0.49.0
## [13] Seqinfo_1.1.0 MatrixGenerics_1.23.0
## [15] matrixStats_1.5.0 BiocGenerics_0.57.0
## [17] generics_0.1.4 BiocStyle_2.39.0
##
## loaded via a namespace (and not attached):
## [1] KEGGREST_1.51.0 rjson_0.2.23 xfun_0.54
## [4] bslib_0.9.0 alabaster.string_1.9.0 rhdf5_2.55.7
## [7] lattice_0.22-7 rhdf5filters_1.23.0 vctrs_0.6.5
## [10] tools_4.5.2 bitops_1.0-9 curl_7.0.0
## [13] parallel_4.5.2 AnnotationDbi_1.73.0 RSQLite_2.4.4
## [16] blob_1.2.4 Matrix_1.7-4 BSgenome_1.79.1
## [19] cigarillo_1.1.0 lifecycle_1.0.4 compiler_4.5.2
## [22] codetools_0.2-20 htmltools_0.5.8.1 sys_3.4.3
## [25] buildtools_1.0.0 sass_0.4.10 alabaster.matrix_1.9.0
## [28] RCurl_1.98-1.17 yaml_2.3.10 crayon_1.5.3
## [31] jquerylib_0.1.4 BiocParallel_1.45.0 jsonvalidate_1.5.0
## [34] DelayedArray_0.37.0 cachem_1.1.0 abind_1.4-8
## [37] digest_0.6.37 restfulr_0.0.16 maketools_1.3.2
## [40] fastmap_1.2.0 grid_4.5.2 cli_3.6.5
## [43] SparseArray_1.11.1 S4Arrays_1.11.0 GenomicFeatures_1.63.1
## [46] h5mread_1.3.0 XML_3.99-0.20 bit64_4.6.0-1
## [49] rmarkdown_2.30 httr_1.4.7 bit_4.6.0
## [52] png_0.1-8 HDF5Array_1.39.0 memoise_2.0.1
## [55] evaluate_1.0.5 knitr_1.50 BiocIO_1.21.0
## [58] V8_8.0.1 rtracklayer_1.69.1 rlang_1.1.6
## [61] Rcpp_1.1.0 DBI_1.2.3 BiocManager_1.30.26
## [64] alabaster.ranges_1.9.1 alabaster.schemas_1.11.0 jsonlite_2.0.0
## [67] Rhdf5lib_1.33.0 R6_2.6.1 GenomicAlignments_1.47.0